Bioinformatics III: Use of Primer BLAST and Primer3

Draft — needs updating for yeast

This exercise is about designing primer sequences for PCR. The handout introduces use of Primer BLAST, which combines use of Primer3 and BLAST to ensure target-specific primers. An excellent tutorial, How to: Design PCR primers and check them for specificity, is available at NCBI Design PCR Primers.

Background on the exercise

The beauty of PCR is that we should be able to know in advance what our products look like. After all, we selected the primers because we expect them to bind to particular sequences in the genome. Given that we know what the sequence is in advance, and that the fly genome, for example, has been sequenced, we can use bioinformatics tools to predict the size of the PCR product given the genome and the designed primer sequences.

With PCR, we know, or should know in advance what products (bands) should be amplified. To confirm the results of PCR, we can subject the amplicon to a round of sequencing, or, more generally, we can compare the size of the product to what we expect from our use of simple bioinformatics tools. Size of products can be obtained by comparing mobility of our product sample in a gel against a set of standard size markers (Ferguson-style plot). Electrophoresis is a very standard, basic tool for separating biological molecules by charge or by size. We routinely use agarose gels in Genetics because they are easy to run and generally give good results.

Question 0. Our goal is to amplify two specific SSR microsatellites from several isofemale fly lines. Explain why obtaining the size of the amplicon from an agarose gel for each fly line may underestimate the differences between the lines for this marker.

Primers to genome target

I wish also to use this exercise to introduce you to more “bioinformatics.” Now, what I mean by bioinformatics in this context is we are going to do a sequence search with our short primer sequences and see where the primers are predicted to anneal in the D. melanogaster genome.

We are looking at a number of different satellites in flies, including DMRHOb (Genbank number X52454) and DROFASI (Genbank number M32311). DMRHOb is two repeats of (AC)10, whereas DROFASI is three repeats of (AGG)5, as reported in Genbank.

Question 1. We may already have primers in mind for this work. Assume you don’t have primers available. For model organisms like Drosophila, numerous validated primers have been developed, and in this case, can be looked up at a database (= FlyPrimerBank at DRSC). Obtain primer set sequences for DMRHOb and DROFASI.

Question 2. From the Table provided in Satellite loci in Drosophila please identify Genbank numbers for at least four additional satellites in the flies.

Question 3. The basic arrangement of the DNA in a genome is into chromosomes. Before you start your bioinformatics work, you need to learn something about the fly genome. So, how many chromosomes does the Drosophila melanogaster genome have? What are they called?

Question 4. In lab 9 we ran PCR on DMRHOb and DROFASI , but I provided you primers sets labeled with shorter names. What were the primer names used in Lab 9 for each of these two SSR ?

Question 5 . Where in the Drosophila melanogaster genome is DMRHOb ( X52454)?

  1. Search name DMRHOb or X52454 at NCBI DNA & RNA page, select “nucleotide” database, enter the number or name in the search box.
  2. Search name DMRHOb or X52454 in FlyBase , enter enter the number or name in the search box called J2G.

Hint: “where in the genome” implies locating the sequence to a chromosome location.

Question 6 . Where in the Drosophila melanogaster genome is DROFASI ( also known as M32311) ?

  1. Repeat search as above at NCBI DNA & RNA page for name DROFASI or M32311.
  2. Repeat search as above at FlyBase for name DROFASI or M32311

Question 7. In Questions 5 and 6 I asked that you do the search in two different databases (A: NCBI and B: FlyBase). Briefly summarize the use of these two databases as tools for answering these questions.

Question 8. Repeat question 5 and 6 for each of the four satellites you found in question 2.

Where do the primers go in the genome?

Questions 9 – 11 go into your notebook

For the two SSR, we are using published primers.

For DMRHOb , the forward primer is TATACTAAAGTCACTTAATGCGTTACA; the reverse primer is GTTTGTGTGAATTTCACTAAATTATTA.

For DROFASI , the forward primer is GATGATTCGGAACTCTCTCAGG; the reverse primer is TTTGCACCAACTGTTTCTGC.

Prior to PCR, we want to know what fragments we are likely to get. You can use BLAST searches in the nucleotide databases, but this search algorithm has difficulty with small sequences when you are searching within a large DNA sequence, perhaps even the whole genome. Thus, NCBI has provided a Primer-BLAST tool that we will introduce, available at Primer-BLAST

Hints:

  • Enter the Genbank number in the “Enter accession” box, then scroll down to “Use my own primers…” and copy and paste the appropriate forward and reverse primer sequence into the available spaces.
  • Scroll down to the Organism box and type in “Droso” — as you type these letters, you should see Drosophila melanogaster (taxid:7227). Select that organism.
  • Scroll down and click on the Get Primers button.
  • A new browser window will open up and, after an update, print out (hopefully) your answer.

Question 9. Using Primer Blast, what is the expected fragment size containing DMRHOb when we use the two primers in the X52454 region of the D. melanogaster genome?

Question 10. Using Primer Blast, what is the expected fragment size containing DROFASI when we use the two primers in the M32311 region of the D. melanogaster genome?

Question 11 applies only if we have results. Fall 2015? We did not get a reliable gel for these SSR.

After running agarose gels, answer the following question. Your answer must be in the form of numbers of nucleotide bases, and it presumes you have completed a Ferguson plot.

Question 11. Compared to our agarose gels, how do these estimates of product size (in numbers of base pairs) compare to our gel results for

  • DMRHOb ?
  • DROFASI?

References

Rex, F., Hirschler, A., Scharfenberger-Schmeer, M., Rex, F., Hirschler, A., & Scharfenberger-Schmeer, M. (2020). SSR-Marker Analysis—A Method for S. cerevisiae Strain Characterization and Its Application for Wineries. Fermentation, 6(4).

Wang, X., Zhang, Y., Qiao, L., & Chen, B. (2019). Comparative analyses of simple sequence repeats (SSRs) in 23 mosquito species genomes: Identification, characterization and distribution (Diptera: Culicidae). Insect Science, 26(4), 607–619.